BLOGS

Cada vez creo en menos cosas Un foro para pensar en lo divino y en lo humano

Me he desayunado con ETA

Son las diez de la mañana. Me he desayunado con la noticia de la bomba de ETA. El objetivo era un cuartel de la Guardia Civil en Durango, continuando con la vieja filosofía de selección de objetivos. Dos guardias heridos leves, pero, como ya sabéis, una bomba ciega, como la de Hipercor, podría haber matado indiscriminadamente a su “objetivo militar” y a sus familiares, esposas y esposos, hijos…

Todavía no he conocido a estas horas del desayuno ningún comentario de la cúpula del PP. Estoy esperando que algún descerebrado achaque a un milagro el que tan sólo dos guardias civiles hayan sido heridos levemente tras la explosión, pero no estaría mal que las fuerzas políticas, de derecha e izquierda fueran tomando posiciones.

De la derecha esperamos que haga un alto en el camino en la utilización de la política antiterrorista en su beneficio, y condene sin paliativos el atentado, sumándose a la trinchera del gobierno, sin adjetivos. De lo que digan, de cómo lo digan, obtendremos pistas sobre si Rajoy piensa hacerle un hueco en lo que queda de legislatura a Ruiz Gallardón (uno de los dirigentes que siempre se ha opuesto a la utilización partidista del terrorismo) o si el espíritu centrista (¿) queda barrido definitivamente por los estertores políticos de la agonizante extrema derecha que codirige su partido.

Y de la izquierda abertzale esperamos lo de siempre. Tienen una ocasión de oro para dejar de amparar política y psicológicamente a los terroristas. Y entre ellos incluyo, como buen test, al conglomerado de izquierda que a punto estuvo de pactar en Navarra un gobierno con los socialistas. No encontrarán mejor ocasión de confesión de intenciones que ésta para despejar dudas, esas dudas que en el PSOE nacional aconsejaron no utilizarlos como incómodos compañeros de viaje hasta las elecciones.

Es un día para retratarse todos.

100 comentarios

  1. Dice ser Simio

    Hugo: critica a Gallardon e insulta a Maria San GilJoaquim: “a estas horas se debe estar descorchando con profusión en la calle Génova”Felipe. G: Vamos a ver con qué nos sorprenden ahora los integristas del PP.Candas: La derecha…de asaltacaminos ya van servidos ;)No se si han leido mal la noticia, pero la noticia es que “Una furgoneta bomba estalla en el cuartel de la guardia civil de durango, ha habido dos heridos”

    30 Noviembre -0001 | 00:00

  2. Dice ser Jose M.

    El presidente se planta ante ETA24 de Agosto de 2007 – 11:01:57 – Luis del PinoMe refiero al presidente Sarkozy, claro está, que ha centrado su visita a Bayona en la lucha contra el nacional-terrorismo. Al otro presidente, Zapatero, la bomba de Durango contra un cuartel de la Guardia Civil le ha pillado con las manos en la masa, tanto en sentido literal como figurado: mientras que el inquilino de La Moncloa se dedica a amasar pan en una aldea de Asturias, sus enviados siguen negociando con los pistoleros y controlando la espita del terror.La explosión de Durango se produce horas después de que un miembro del PSN defienda el derecho del Gobierno a volver a negociar con Batasuna-ETA, como si alguna vez hubieran dejado de hacerlo. Y se produce mientras que asistimos a un recrudecimiento del vandalismo callejero, a una permanente provocación mediante manifestaciones convocadas por la izquierda terrorista vasca, a un continuo desafío a la legalidad por parte de los recogenueces del PNV, a un continuo acoso a ese PP que se ha convertido en el único partido democrático que queda en el País Vasco. Todo ello ante la permanente pasividad de un Gobierno de la Nación para el que ETA no es sino un compañero de viaje sin el cual no cabe culminar el golpe de estado permanente iniciado el 11-M.Esta vez ha habido suerte, señor presidente, porque no se ha producido ningún “accidente mortal”, como en la T4. Tan sólo dos heridos leves. Pero la posibilidad de que haya algún nuevo “accidente” se irá incrementando a medida que vayan ustedes abriendo la espita del terror. Y el problema es que son ustedes tan torpes que van a necesitar abrirla mucho antes de darse cuenta de que el terror ha perdido su efectividad como narcótico.Y la ha perdido porque hace ya mucho tiempo que somos conscientes de que el “proceso” no se inició para poder acabar con ETA. Esa banda asesina estaba ya muerta cuando usted llegó al poder, señor Zapatero, así que no había necesidad de matarla de nuevo. Bastaba con rematarla. Pero a ETA se la revivió precisamente para poder poner en marcha el “proceso”, ¿verdad, señor presidente? El “proceso” que necesitaban los que le han colocado a usted en el puesto que ahora ocupa.

    30 Noviembre -0001 | 00:00

  3. Dice ser Kim

    Jose M.: Has estado en el Pais Vasco alguna vez?. Que ETA estaba muerta?. No tienes ni puta idea de lo que es aquello. Ahora si hablar así os sirve para ganar votos me parece muy bien, es una táctica mas dentro de la basura política.

    30 Noviembre -0001 | 00:00

  4. Dice ser Proust

    -Siempre hay que estar dando gracias a Dios, decía un cura al albañil que estaba reparando la techumbre de una iglesia y cayó entre unas vigas, rompiedo varias costillas, pero salvando la vida.-¿A ése?, replica el albañil, ¡no le vi yo la intención…!Hoy le hemos visto la intención, una vez más a los asesinos. Han fracasado porque no han conseguido el objetivo que perseguían.Hay que felicitar a todos los guardias y familiares que han conservado su vida, que ha estado en riesgo. Como le hemos visto la intención a los asesinos, merecen toda la repulsa de la gente decente, de verdad, no de los cínicos que todos conocemos.No hemos sabido hasta ahora la opinión de los más dicharacheros peperos. La realidad les ha estropeado otra de sus coartadas más productivas. A ver si la reincorporada San Gil y Oreja, el sempiterno vigilante del ojo medio abierto, se desmienten, por decencia.En cuanto a Rajoy, España no puede estar en los momentos difíciles con un lider de la oposición escondido, u observando de qué lado sopla el viento en su partido, o preparando una nueva soflama contra Zapatero, errando el tiro una vez más.Ya se les nota demasiado.

    30 Noviembre -0001 | 00:00

  5. Dice ser Jose M.

    KimETA esta mejor que hace 4 años?si o no?La pregunta sera si tu has estado o has vivido en el Pais Vasco.

    30 Noviembre -0001 | 00:00

  6. Dice ser Vicente

    Cuando una coincidencia se repite de manera constante ya no se puede hablar de tal, sino de estrategia. Cada vez que la intención de voto al PP baja o se estanca, ETA se encarga de darle un empujoncito.Todos tenemos claro que el PP (partido del orden duro) se beneficia de la actividad de ETA y que cuanto más presiones a los vascos más afiliados tiene ETA. Así pues, estimados trolls, ambas “bandas” encajan como un guante.Mi titular es “ETA abre la pre-campaña del PP”. ¿´Qué extraños contubernios existen entre ambos? ¡¡QUEREMOS SABER!!

    30 Noviembre -0001 | 00:00

  7. Dice ser pericles

    El PP, de momento, no ha comenzado todavía a manipular. Jose M., sí. ¿El PP es el único partido democrático que queda en el País Vasco? ¿Por qué? ¿Por qué no quiere negociar con ETA? Democracia y negociación siempre están unidas. Lo mismo que empecinamiento y totalitarismo. ETA ha estado y sigue estando en horas bajas. Pero su capacidad de hacer daño y matar siempre ha estado en disposición de ser utilizada.Coordinación con Francia y con Portugal, persecución policial y encausamiento judicial de los terroristas y sus colaboradores y puertas abiertas a quienes decidan abandonar la lucha armada y defender sus postulados desde las instituciones, como hacen ya Aralar y Nafarroa Bai condenando la violencia, o en su momento hicieron otros etarras, son las armas del verdadero demócrata. Y todo esto se ha estado haciendo desde el principio de la llamada “tregua” y de la apertura de negociaciones. ¿No siguieron las detenciones y los juicios? La posibilidad de diálogo ahora mismo con ETA está cerrada. La cerraron ellos con el bombazo en la terminal 4 de Barajas. Tendrán que pasar unos años y apreciarse fehacientemente otras actitudes para volver a abrirla. Pero la puerta nunca puede estar permanentemente cerrada. Firmeza no es lo mismo que encastillamiento. La firmeza de verdad siempre debe ir unida a la mano tendida. El llamado palo y la zanahoria. Si cumples una serie de condiciones, ven. Si no, eres un fuera de la ley y el Estado de derecho cumplirá con sus obligaciones. No deberíamos nunca olvidar estos fundamentos básicos en una democracia decente.Saludos.

    30 Noviembre -0001 | 00:00

  8. Dice ser Simio

    Vicente: Eso es como pensar que existe un contubernio entre el PSOE y Alqaeda. Lo digo por lo del 11M. Es totalmente delirante y absurdo por suerte se ha demostrado en el juicio y en las comisiones del 11M.Pensar que ETA y PP tienen un contubernio es calumniar al PP sin fundamento.

    30 Noviembre -0001 | 00:00

  9. Dice ser Jose M.

    periclesAmbrosio Fernandez,Quien no ha condenado el atentado que costo su vida… solo tienes que abrir este blog desde primeros de marzo.Y luego me hablas de manipulacion, que aqi sabemos todos lo que ha escrito cada uno, de que sirve que escribas… “de HB no espero nada”…eso se lo dices a Z-ETA-P, que ha estado sentado durante cerca de 6 años con ellos, preguntatelo a ti mismo, tras el ” accidente de la T4″ …aqui el PP o yo , ya que dices que manipulo, lo que digo yo no ha cambiado, de hace 10 años, hace 5, hace 2, hace 1 o hace 6 meses…de ti, y de los otros palmerillos no se puede decir lo mismo, quien es el que manipula?tu mismo.Sr. Saco, es usted un hipocrita.

    30 Noviembre -0001 | 00:00

  10. Dice ser pericles

    Vaya, veo con desilusión, en el enlace que nos ha dejado Felipe Punto G., que los del PP no han tardado en condenar tras el atentado a… el Gobierno y al PSOE. La manipulación del terrorismo con fines electoralistas continúa. Veremos que dice Rajoy.Saludos.

    30 Noviembre -0001 | 00:00

  11. Dice ser fingon

    Pobre Manuel, te imagino por la mañana tomandote tus chococrispies, con el cafe con leche disfrutando de tus vacaciones, y plaf, la radio… corre que te corre al portatil, escribes febril tacatacatacatacatacatca, rapido, no te puedes descuidar, hay que activar las contramedidas, que no se desmadren las masas, hay que recordar que el PP puede aprovecharse, rapido rapido, eso tiene que ser el nucleo de tu argumento, luego como lo maquillo, A SIII, los nacionalistas, eso eso, que no dejen de amparar. A ver a ver, a si, Gallardón, hay que apoyarlo, eso que le hagan hueco, Esperanza, QUIEN ES ESA, mmmmm, veamos, Navarra, vale, que si conglomerado pum pam, vale, a ver digo esta vez que Nafarroa Bai es una estupidez de partido que engloba a extrema derecha y extrema izquierda y que tiene menos sentido su existencia como ente politico que Gladiator II o me lo callo, a joer, me lo callo que mi objetivo es que Miguel Sanz se hunda, buffffff, menos mal termine, ya me puedo limpiar el sudor de la excitación y acabarme el medio sobao pasiego, esto de salvaguardar el ideario y el control de masas me supera.Una pequeña parodia dentro de la tristeza que da que unos bestias, le pongan un bombazo a uno, con la excusa del patriotismo más barato, y la demagogia que acabamos haciendo todos.Señores hoy unos animales han puesto una bomba, han intentado matar, preguntemos por que, hacia donde nos lleva, y pidamos responsabilidades a quien hemos votado, simplificando “si un fontanero no me hace bien una reparación, en cuanto pueda, llamo a otro fontanero y que pruebe otra cosa”

    30 Noviembre -0001 | 00:00

  12. Dice ser Vicente

    Amigo Simio, creo que está claro que el pretendido contubernio NO EXISTE. Todos estamos seguros de ello, pero lo cierto es que la estrategia del PP se basa en la actividad de ETA para desgastar al Gobierno y la dureza del PP con todo lo que suene a vasco beneficia a ETA. Se trata de una broma cáustica, reforzada por el ¡¡QUEREMOS SABER!! del final.Todos tenemos la suficiente inteligencia para no ver contubernios raros, delirantes y contra-natura en política. ¿He dicho todos? Porque una mayoría de votantes del PP sigue escuchando la COPE con fruición y creyendo a pies juntillas en la conspiración.Un último apunte. Zapatero no ganó las elecciones porque estallaran las bombas del 11M, sino por la desfachatez mentirosa de sus dirigentes (y esto también ha quedado claro en el juicio. Recuerda que a mediodía Acebes ya sabía lo que pretendía ocultarnos).Me sigo apuntando, para vergüenza de los que lo gritan en las manifestaciones, a la coletilla de uno de nuestros contertulios habituales: ¡¡QUEREMOS SABER!!

    30 Noviembre -0001 | 00:00

  13. Dice ser pericles

    Jose M., en mi caso personal, siempre he condenado y condenaré los atentados de ETA. Lo propio hice con el de la Terminal 4 y con el de hoy. Y lo propio han hecho todos “los palmerillos” que tú indicas.También apoyé al gobierno de Aznar cuando la tregua del 98. Y la mayoría de los “palmerillos”, también. ¿Qué hiciste tú en aquellos tiempos? ¿Y cuando se acercaron los presos al País Vasco? ¿Y cuando ETA era el Movimiento Vasco de Liberación? Supongo que lo mismo que hacían los del PP y los de la AVT con su presidente a la cabeza, aplaudir rabiosamente y pensar que los de ETA, en aquel tiempo, eran “hombres de paz”. Quienes habéis cambiado de postura sois vosotros, no los que siempre hemos defendida la misma: firmeza contra el terrorismo y diálogo con quienes abandonen la violencia. Tanto en aquellos tiempos como en los actuales se os ve con mucha claridad, tanto el plumero como la catadura moral. Sólo os interesa ETA cuando estamos hablando de votos. Y de veras que siento que esto sea así, porque creo que contra ETA y contra la violencia deberíamos estar todos juntos. Pero vuestra manipulación de un asunto tan grave como éste, resulta absolutamente inaceptable. ¿Acaso crees que sí hubiese gobernado el PP y se hubieran dado las mismas condiciones este partido no haría lo mismo, negociar el abandono de la lucha armada? Lo que sí que han hecho ha sido hipotecar para el futuro una negociación, porque va a ser muy difícil explicarla tras la actitud tomada hasta la fecha. Y otro asunto, tengo muy claro. A ETA le interesa que gobierne el PP con su “firmeza” para seguir defendiendo su “lucha armada” y sus actitudes mafiosas. Si les ofreces la mano, les quitas los argumentos, y tienen que inventárselos, como han hecho en esta ocasión pasada.Por cierto, ¿qué diferencias ves entre ser palmerillo del PSOE o serlo del PP? Yo, ninguna.Saludos.

    30 Noviembre -0001 | 00:00

  14. Dice ser anatema

    ¿Ve Ud., Sr. Saco, como la ETA no es tan peligrosa? En el caso de que no fuese Ud. miembro de la Benemérita, viviese en el País Vasco, o tuviese la mala fortuna de transitar por lugar y en hora equivocados (no más probable que la de caerle una rama de un árbol en la cabeza), ni a Ud. ni a mí nos afectaba el atentado de la ETA.Comprobará Ud. que el terrorismo local no es tan importante como nos lo quieren pintar, para que no estemos pendientes mientras de la economía (ésa de cuya información este diario con sabático agosto, excepto su parte digital, carece). Ni estemos tampoco pendientes del regularestar social, ni de las posibles consultas al Pueblo Soberano sobre la Iglesia, o sobre la Corona, o sobre los JJ.OO. del 2016… Ni del bipartidismo, las listas cerradas, los casos de corrupción urbanística o de toda índole.A TODOS nos harían un gran favor Uds. los periodístas, y los sinvergüenzas de los políticos si dejasen de una puta vez de hablarnos de la ETA a los que no vivimos en el País Vasco. Más que nada por hablar de otras cosas, sigo yo, como las medidas que podría tomar el Ejecutivo para limitar los pingües beneficios de la banca a costa del encarecimiento del precio del dinero… Uisss, no, de eso no, que luego los probes ex-menestros tienen que colocarse de Consejeros en alguna parte…

    30 Noviembre -0001 | 00:00

  15. Dice ser Pascual

    Pepe Polémico, olvidas la base fundamental del derecho, el axioma de que “La Costumbre hace Ley”. Para que me entiendas, la sensación que tuvieron esos cincuenta o cien mil o cuantos sean, durante la época franquista, fue similar (entre comillas) a estar en una cárcel. ¿Sirvió eso para algo? El imperialismo, madre del cordero en este asunto, fue muriendo en el siglo XIX con los únicos estertores de algunos lugares donde por razones de cercanía o de una gran implantación sumada a unos privilegios escandalosos (como era el caso de Sudáfrica) todavía aguantaron/aguantan más tiempo. La eterna disputa sobre la soberanía española o vasca de esa región no puede ser eterna. Un día se hará por fin un referendum y se optará por lo que decida la mayoría y nadie de fuera tendremos ningún derecho a decidir sobre ello. Lo triste es que ese día todas las víctimas de este conflicto habrán muerto únicamente para satisfacer el estúpido y trasnochado ansia imperialista de algunos descerebrados. ¿Quién se acuerda hoy de los que murieron en Filipinas por ejemplo para defender la unidad del imperio?Otro tema es la repercusión a nivel “mentidero” que los nostálgicos del imperio están consiguiendo que se cree entre la gente de a pie, o sea nosotros. Debería preocuparnos infinitamente más el estado de las carreteras y de la normativa de circulación por pura lógica, es un tema que tiene muchos más muertos en su haber, pero aquí estamos, discutiendo sobre si los de Eta son galgos o podencos…..

    30 Noviembre -0001 | 00:00

  16. Dice ser smg310

    Pepe Polémico hace algunas observaciones interesantes y que conducen a enriquecer la polémica.No es verdad absoluta e incontrovertible que las autoridades competentes no negocien con delincuentes. Se negocia y se acuerdan transacciones con todo tipo de organizaciones mafiosas, o con destacados miembros, para conseguir su desmantelamiento. Y por supuesto con los defraudadores de hacienda se negocia e incluso se aceptan sus propuestas de regularización. Es mas la propia fiscalía renuncia a presentar acusación contra ellos. En España se ha llegado incluso a la modificación del Código Penal para evitar la condena a prisión de la cúpula de un gran banco.A mi me parece que acabar con ETA es un asunto de higiene pública, pues infecta desde hace mucho tiempo la vida política y ha conseguido que las cuestiones sin resolver se encuentren en situación crónica. No hay peligro de muerte, pero la salud no mejora, ni se espera que lo haga.Amigo Pepe, la paz es necesaria e imprescindible para que cualquier idea o propuesta política pueda ser formulada, defendida, debatida y resuelta por cauces democráticos. En eso no hay disputa, al menos no debería. ¿Pero estamos de verdad en una situación de guerra, o conflicto que por su magnitud haga imposible la discusión política si antes no se llega al armisticio?. ¿O no será que la excusa del conflicto, o mejor de los asesinatos, da pié y argumento para eludir e incluso negar la posibilidad de alcanzar la solución política?.Yo creo que se trata de esto último, con o sin terrorismo no se aceptan otras ideas, otras propuestas, ni tampoco se está dispuesto a que se puedan presentar en el parlamento.Salud

    30 Noviembre -0001 | 00:00

  17. Dice ser Simio

    Nadie parece decir nada. Incluso en GARA no dicen nada. Por ahora,

    24 Agosto 2007 | 10:24

  18. Dice ser Hugo

    Pues a Gallardón no le he visto yo que se pierda una sola mani de la AVT en las que se acusaba a todo el mundo mundial de complicidad con ETA.Por otra parte es posible que hoy en concreto no hagan declaraciones demasiado fuertes (salvo María San Gil, que se habrá curado del cáncer, pero sigue fatal de lo suyo), pero con los días volverán sin duda a aguijonearnos.Como el escarabajo del cuento, lo llevan en su naturaleza.

    24 Agosto 2007 | 10:36

  19. Dice ser Fétido

    Yo he oído a Uxue Barcos condenar sin paliativos el atentado. Cosa que, por otra parte, he observado siempre en relación a Nafarroa Bai.

    24 Agosto 2007 | 11:06

  20. Dice ser Joaquim

    ETA acaba de dar por inaugurada la campaña electoral. Vamos a ver qué cintura tiene el Gobierno para esquivar la embestida, y sobre todo para evitar los taponazos del champán que a estas horas se debe estar descorchando con profusión en la calle Génova; no ha habido ningún muerto, pero todo es cuestión de tiempo y volver a intentarlo.Cuando la tregua, parecía que en esa gente -en ETA, no en el PP- quedaba un gramo sino de cordura sí al menos de inteligencia. Después del atentado de la T-4 quedó claro que no. Pero esto de ayer certifica que estos pobres diablos no es que no les quede inteligencia, es que ya no tienen seso ni para pensar en su propio futuro personal.Qué hermoso regalo electoral el que acaba de hacerle ETA al PP.Eso sí, si tanto se quieren deberían casarse, que vivir en concubinato es pecado mortal.

    24 Agosto 2007 | 11:09

  21. Dice ser Felipe Punto G

    Esta semana tanto María San Gil como Mayor–Oreja han insistido en que el gobierno seguía negociando con ETA y que la situación actual era un apaño entre ambos. Vamos a ver con qué nos sorprenden ahora los integristas del PP.

    24 Agosto 2007 | 11:12

  22. Dice ser Candás

    “De la derecha esperamos que haga un salto en el camino”Mejor que haga un “alto”, porque de asaltacaminos ya van servidos 😉

    24 Agosto 2007 | 11:12

  23. Dice ser Jose M.

    Ambrosio Fernandez.hipocrita.

    24 Agosto 2007 | 11:12

  24. Dice ser Marta

    Alegrémonos de que no haya muertos y crucemos los dedos para que no pase nada más grave de aquí a las elecciones.http://unacancionparati.blogspot.com/

    24 Agosto 2007 | 11:24

  25. Dice ser pericles

    Creo que todos, desde la bomba en la Terminal 4 de Barajas y tras el anuncio de ETA de la ruptura de su “tregua”, esperábamos que de un momento a otro esto pudiera ocurrir. De momento, no ha habido víctimas mortales. Pero demos tiempo al tiempo. Se han evitado varios atentados y de momento, desde lo de Barajas, no ha muerto nadie, pero las bombas matan y la desesperación y la falta de oportunidades para poder llevar a cabo sus atentados, pueden tener consecuencias funestas.Esperemos que el espectro político actúe con responsabilidad. Del gobierno espero condena y trabajo para seguir evitando atentados y deteniendo a los terroristas, y creo que debería evitar, en lo posible, hacer ninguna referencia al principal partido de la oposición. Del PP espero que condene el atentado sin paliativos y no haga interpretaciones políticas, ahora mismo, fuera de lugar. Si de verdad quieren la unidad de todos los demócratas contra el terrorismo ya saben lo que tienen que hacer. No manipular con fines electoralistas. También, como se ha apuntado, creo que es un buen momento para que Nafarroa Bai demuestre que es partido democrático que no cree en la violencia como forma de obtención de objetivos. Una condena contundente puede demostrar que es un partido apto para poder participar en tareas de gobierno en las instituciones. De Batasuna no espero nada, ya que están sujetos a lo que digan sus “jefes militares” y ya han demostrado suficientemente que todavía no están preparados para participar de forma honesta y leal con una democracia homologada.Saludos.

    24 Agosto 2007 | 11:26

  26. Dice ser Manuel Saco

    Candás, tienes razón. Mejor un alto. Corrijo el tiro (con perdón).

    24 Agosto 2007 | 11:44

  27. Dice ser Vicente

    ¿Ves, Simio, como enseguida Fignon aprovecha el atentado para pedir cambio de fontaneros? Por favor, que alguien enseñe a Jose M. a poner en orden sus ideas, porque marea leer sus comentarios. Por cierto que no es sólo Fignon, porque el enlace de Felipe G es rotundamente esclarecedor.¡¡QUEREMOS SABER!!

    24 Agosto 2007 | 13:02

  28. Dice ser Hugo

    Simio: critica a Hugo, Joaquim, Felipe G y CandasNo se si ha leido mal la noticia, pero la noticia es que “Una furgoneta bomba estalla en el cuartel de la guardia civil de durango, ha habido dos heridos”(este mensaje es, lo sé, simplista y demagógico, lo sé, porque Simio puede centrarse en otras reacciones que no le gusten -aunque diga que hay insultos donde no los hay- por ejemplo porque no encuentre nada diferente que aportar sobre la noticia de la bomba, que al fin y al cabo es algo que todos esperábamos y sobre lo que no creo que haya mucha gente que pueda aportar cosas originales de cosecha propia. Pero seguro que a algún simple se le ocurriría hacerle esa crítica)

    24 Agosto 2007 | 13:03

  29. Dice ser smg310

    Ya tenemos entretenimiento para esperar a un “Rato”. ETA estaba muerta, pero organizó el 11M. Pues ese muerto gozaba de muy buena salud. Tan buena que incluso pusieron al PSOE en el gobierno.Otra perla es que el terror ha perdido su efectividad como narcótico. Pues los señores que manejan el mundo no se han enterado, a ver si leen el blog de Manolo Saco, y dejan de fastidiarnos con los controles y las amenazas de armas de destrucción masivas, las enfermedades, las epidemias, y por supuesto con los muchos terrorismos que nos amenazan. Y sin olvidar el temor a las catástrofes financieras, que esas sí que dan miedo.Y por supuesto patriotas, ¡no faltaba más! Y además izquierdistas, con lo malos que son. Aunque pasamos por alto que estos asesinos y quienes les protegen precisamente no defienden ideales de izquierda. Ellos se autodenominan patriotas.Qué bien que vienen los terroristas para apaciguar los ánimos de los que pensaban protestar por el encarecimiento de las hipotecas y el “boom” del empleo a tiempo parcial y sin condiciones. Y el caso es que lo de menos son los muertos o heridos, que esos de verdad no le importan a nadie. Como no sea que los muertos por ETA estén bendecidos por los sacerdotes de las virtudes patrias. ¡Hipocresía!.Pero para la causa todo es bueno, y si se trata de una locura de ETA lleva premio añadido, porque de otros terrorismos la gente pasa mucho. A ver si de una vez se acaban las guerras carlistas y se queda cada uno en su casa.Salud.

    24 Agosto 2007 | 13:07

  30. Dice ser Simio

    Hugo: Si de lo que se trata es de “aportar cosas originales de cosecha propia” me parece muy acertado tu comentario. Bueno pensandolo bien, cirticar al PP cuando ETA pone una bomba, tampoco es nada original.

    24 Agosto 2007 | 13:20

  31. Dice ser Beta

    En el PP lamentan que no haya habido victimas. Es muy duro que la “malisísima” política antiterrorista de Zapatero arroje dos muertos en toda la legislatura mientras que su “buenisisima” politica terminó con mas de 70 muertos (11-m aparte). Ademas es triste que se les olvide condenar los atentados por estar más atentos a pedir rectificaciones ventajistas. Cada día se parecen más a HBhttp://madreidiota.blogspot.com

    24 Agosto 2007 | 13:55

  32. Dice ser Jose M.

    periclesTu argumento, de “firmeza contra el terrorismo y diálogo con quienes abandonen la violencia” no vale ni una mierda.O sino me explicas lo del accidenteO sino me explicas lo de la extorsion “amable”O sino me explicas las 19 detenciones de etarras en el 2006, 19… un gran numero, la primera vez que los frnaces han detenido mas etarras que la policia española.O sino me explicas la no condena, del atentado que costo la vida de Ambrosio Fernandez, y ese son los hechos.O sino me explicas el hecho de ANV… ni ha condenado, ni condenara este atentado y que han hecho o va hacer el gobierno?O quien ha mentido al congreso? se cumplio la resolucion del comgreso?O sino me explicas con quien estabn dispuestos a gobernar el PSOE en Navarra?O me explicas lo de las 350 pistolas…y el dudo que sea ETA?Lo que no entiendo es la bajeza de tu argumento, hablar con los que rechazen la violencia… quien ha rechazado la violencia? cuando? como y donde?…lo tuyo fue… hablar, ceder… independientemente que maten o pongan bombas… el para que? o porque ? ese es vuestro problema, pero no mientas que eso es lo que ha pasado.Por cierto, ahora criticais al PP porque? por decir Pacto Antiterrorista, que es lo mejor que ha funcionado… coherencia, se pide al gobierno coherencia… cosa que ni tu ni tu gobierno la ha tenido.Ps: entiendo que ya has asimilado que sea palmerillo del Psoe, la unica diferencia entre tu y yo, es que cuando llegue el momento yo pondre a parir al PP, algo que tu en la vida lo haras con el PSOE , y sino, tiempo al tiempo.

    24 Agosto 2007 | 14:05

  33. Dice ser Joaquim

    Se nota que el facherío anda excitado, en éste y en otros blogs; han olido sangre, y eso les despierta el instinto predador. Veremos si ETA les sigue echando carnaza, que parece que sí.Hasta las generales quedan apenas seis meses de arduo trabajo pero todo es ponerse, ¿eh, chavales?. Consigna genovesa: olvidad el 11-M, ahí ya no hay nada que rascar, y clamar todos a coro:¡ETA, ETA, ETA!. Un día y otro. Porque es sabido que cuando la invocan, ETA hace como todo espectro que se precie: se presenta.Con todo, los seres racionales sabemos que es imposible que vuelvan los “felices noventa”, pero ellos -PP y ETA- no lo saben, o hacen como que no lo saben. Da igual. Lo importante es la santidad de los fines que los compinches pretenden, no les medios que se vean obligados a aplicar, ¿verdad?.Los dos periódicos nazis, El Mundo y Gara, viejos camaradas, vuelven a combatir del mismo lado de la trinchera. Sus amos también. En realidad, ¿han dejado de hacerlo alguna vez?.

    24 Agosto 2007 | 14:28

  34. Dice ser El Buen Salvaje

    “Me he desayunado con ETA”¿Te has untado con ETA y luego te has comido? jajajajaaaaaaaa

    24 Agosto 2007 | 14:36

  35. Dice ser esceptico

    Las bombas de ETA benefician al PP. Nada les gustaría más a unos cuantos – no todos claro – descerabrados del PP que los descerebrados de ETA se lo pusieron duro al gobierno. Y al que le parezcan duras mis palabras que recuerde los días del gobierno de la república… Nada les gusta tanto a los “salvadores de la patria” como la confusión. A río revuelto…

    24 Agosto 2007 | 14:51

  36. Dice ser pericles

    Jose M., tus argumentos, por ya repetitivos y con apariencia de equidistancia, si que no valen ni una mierda. Sin embargo, si siempre has pensado lo mismo sobre que con ETA sólo pueden existir la firmeza política, la persecución policial y judicial y nunca negociar nada, mis disculpas, porque siempre has sido coherente. Lo mismo que yo, pero al contrario, ya que en mi caso siempre he sido partidario de la firmeza combinada con el diálogo y la puerta abierta a una negociación al abandono del terrorismo. Lo mismo con Zapatero que con Aznar.Las detenciones en Francia o España y los juicios y condenas contra terroristas han seguido teniendo lugar durante estos últimos años. Algo que, sin embargo, no ocurrió cuando la anterior tregua durante el gobierno de Aznar, cuando sí que se cedió en política penitenciaria y se produjeron más concesiones, algo que no ha ocurrido durante esta última tregua. Que tengan lugar más detenciones en Francia que en España tampoco tendría que causarte tanta extrañeza, ya que si la mayoría de los activistas se encuentran en territorio francés, es algo de pura lógica.Eso de que ETA estaba más débil ahora que, por poner un ejemplo, antes del 11-M, es una falacia que no os creéis ni los más serviles con el PP. ETA sigue tan débil como en aquel instante, si no más todavía, a pesar de todos sus intentos de rearmarse que indicas, algo que también hizo con mayor éxito, en la anterior tregua.Sobre el gobierno de Zapatero se me ocurren muchas críticas, tanto en asuntos económicos, como educativos, como de política exterior, como de política fiscal, por lo que no tengo muy claro lo de ser su palmero. Pero sobre este asunto de intentar una solución dialogada con los terroristas de ETA, con el apoyo de la mayor parte del Parlamento y de las fuerzas políticas representadas, salvo el P, creo que ha actuado por perfecta coherencia, salvo, claro está, con excesivo optimismo y quizá un poco de falta de prudencia.En cuanto a tu pretendida equidistancia con el PP, dime una cosa. Si por negociar con ETA, Zapatero es Z-ETA-P, siguiendo con los jueguecitos de palabras ¿Cómo denominarías a Aznar? ¿Aznar-eta?Saludos.

    24 Agosto 2007 | 14:59

  37. Dice ser pericles

    FE de errores, donde decía más débil ahora que entonces, quería decir más fuerte.Saludos.

    24 Agosto 2007 | 15:01

  38. Dice ser julipan

    escepticosois unos golpistas, porque os beneficiasteis del 11m, brindasteis con champan el 11m, hicisteis concectraciones delante de partidos politicos en la jornada de reflexion de unas elecciones, intimidasteis a politicos de un partido el dia de las elecciones y los agredisteis.sois unos golpistas y estais con la manos manchas de sangre.

    24 Agosto 2007 | 15:05

  39. Dice ser Vaseustéalgüano

    El hombrecito del saco como siempre:los violentos, la izquierda abertzale ¿izquierda? ¿No habiamos quedado que eran una pandilla de fascistas? ¡¡Calla, killo!!, si los fachas son los del PP o mejor, “descerebrados” que creen en milagros en lugar de creer en los “hombres de paz”.En fin, esperemos el momento en que podamos pasar factura a estos nazis patriotas de la Euskoguarreria y a todos los plumiferos y gentuza que los apoyan

    24 Agosto 2007 | 15:06

  40. Dice ser esceptico

    “sois unos golpistas y estais con la manos manchas de sangre”. Eres un extremista. Mis manos no pueden estar más limpias. Yo voté cabreado contra la manipulación y la mentira de Aznar y su camarilla. No tuve que hablar con nadie para decidir que me estaban engañando. Yo no tengo carnet de ningún partido y voto a quien me da la real gana y como muchos españoles voté EN CONTRA DE LA MENTIRA Y LA MANIPULACION. Empieza a acostumbrate.Si tú llamas golpismo a lo que libremente deciden los ciudadanos allá tú con tus problemas de diccionario.El problema de la extrema derecha que gobierna el PP es que todavía creen en el derecho divino de que el gobierno de este país les pertenece. “Por la gracia del Dios”. Pues va a ser que NO.

    24 Agosto 2007 | 15:10

  41. Dice ser Jose M.

    PericlesO mientes por conocimiento y entonces eres un embustero ( el caso del Sr. Saco ) o mientes por ignorancia.las 19 detenciones de tu gobierno,son suficientes? eso es lo que tu dices una eficaz labor policial ? o el chivatazo? o los siete tiros?Sois tan palmero que ni siquiera reconoceis que ahora con ANV en el gobierno, los etarras estan siendo subvencionados por el estado, y todo eso se debe a Z-ETA-P, pero eso tampoco lo reconoceras…Cuando mato ETA a Joseba Pazaga, estaba ETA condenando la violencia? y sin embargo ETA se reunia con el PSOE\PSE,( reconocido hasta por el maltratador Eguiguren ) entonces dificilmente puedes decir que dialogo cuando dejen la violencia, cuando te vale el dialogo con violencia y sino la T4 que es?tu mismo.

    24 Agosto 2007 | 15:11

  42. Dice ser julipan

    escepticoy tu un golpista que apoyas a ETA, y a Z-ETA-P , es decir, a la misma mierda.

    24 Agosto 2007 | 15:30

  43. Dice ser O patatero

    Decir que si hubiera habido muertos lo estarían celebrando en la calle Génova con chanpan. Esto es de una persona sin escrúpulos humanos y de un fascismo totalitario de la peor catadura moral del ser humano.Os debería de caerle cara de vergüenza, el tan siquiera el pensar que hay gente que se pudiera alegrar de que hubiera habido muertos. Esto los únicos que estarán insatisfechos será los etarras, por no haberlo con seguido, pero no creo que las personas bien nacidas, se les pase por la imaginación esto que vosotros decís en este blog, sobre el partido popular. Dais pena, veros lo miserables que sois y digo bien, miserables y mala gente, todos los que piensa de esta forma. Piensa los ladrones que todos son de sus condiciones. Todos lo que pensáis de esa forma, sois carroñeros, de la especie más despreciable.Esta clase de des ayunos tan tempraneros Suelen ser de digestión pesada, para días y quedaran las secuelas, las cuales no darán ni tiempo a reflexionar. ETA esta vez fueron a por todos y todas lo volverán a intentar en corto espacio, bien en otro lugar, donde puedan hacer el daño mayor, puesto que aquí dentro del mal, fue gracias a lo que uno pueda imaginar una gran suerte de que no allá habido muertos. Esto suma otra, pagina más en la historia de estos asesinos.Esta visto que el pulso esta echado.No importa la hora, ni el lugar de los hechos, lo mismo puede ser hoy que mañana pero lo que no cave duda que lo intentaran de nuevo en un cuartel de la guardias civiles ,que mañana un colegio de niños o un garaje, o que en una cafetería. Pero esto ya comenzó. Yo me creo y es mi opinión, que esta gente estuvieron amagando según les fueron poniendo y según les fueron negando y quitando. Se cansaron y ahora se les vio que vienen en plan de matones y de dar fuerte.Llegaran momentos que nos tendremos que lamentar y sufrir: por que a esta gente no se les puede hacer ver nada más que lo que les espera es la cárcel y `para eso, es necesario la firmeza, i no el estar dándoles esperanzas de que lleguen a creerse que podrán salirse con la suya y conseguir lo que desde la fecha de su fundación de ETA, vienen exigiendo a todos los gobiernos: los cuales fueron de otra madera de roble y este gobierno es de aya. Don las aya. Zapatero estuvo y esta dándoles esperanzas. Cuando lo que debería haber echo es a verles perseguido desde el primer momento que llego al poder: hizo todo lo contrario, de los de más gobiernos, darles esperanzas y por lo que sebe, ya le calaron de que les estuvo entreteniendo y ahora mas cuando se ha cercan elecciones. Parece ser que ETA lo ha calado y hay esta la respuesta. Si hubieran formado una piña de unión con el partido de la oposición y les hubiesen echo caso de haber continuado la línea de los anteriores gobiernos esto estaría total mente terminado…. El gobierno y Zapatero en concreto deberían de una vez para siempre, hablar claro a los ciudadanos de este país y no han dar con tapujos y posicionarse en la línea que desde un principio les aconsejo el PP. Yo jamás votare a un gobierno que no es claro con el pueblo. Esta persona le van ir saliendo todo el entramado que ha tenido hasta hora con ETA. Por que se ve que estos se han cansado, también de que los engañen. Bueno de echo, hasta los mismos socialistas ya le empieza a poner en duda.Ver, par creer. Entre capitalista, anda el juego. Estos enlaces lo acreditan.¿Quien ganara la partida? Las cosas no son como se piensan sino como, salen al final del recuento. Tu tanto yo más y tú menos y mandas menos, ¿o no? esto es la historia del don dinero y el politiqueo. Lo de más es jugar al mus.http://www.periodistadigital.com/periodismo/object.php?o=204361&p……http://www.hazteoir.org/modules.php?name=Noticias&file=article&si……

    24 Agosto 2007 | 16:11

  44. Dice ser smg310

    Pues sí hay gente que piensa que para acabar con ETA hay que organizar un duelo al estilo de OK CORRAL.Y el caso es que cuando más cerca se estuvo de acabar con ellos fue empleando el dialogo, vamos que se sentaron a conversar. Lo consiguieron algunos que sabían que para acabar con ellos había que hablar con ETA, no con la madre Teresa de Calcuta.Juan José Roson, Bandrés y Onaindía entre otros tenían claro el camino, por supuesto algunos partidos también, excepto el que mantenía que el mejor terrorista era el terrorista muerto. Así nos va.En fin habrá que hablar entonces con el cuñado de Zaplana, ese íntegro militar que cambió “el todo por la patria” por “el todo por la pasta”.Salud

    24 Agosto 2007 | 16:20

  45. Dice ser Cris

    Bueno, pues van pasando las horas y ya conocemos algunos retratos de los que tienen que retratarse. ZP ni está ni se le espera, aunque lo mismo hay que decir de Rajoy. Acebes ha salido a condenar pero ¡ay! no se ha metido con el Gobierno, qué fallo, ya no van a poder decir que el PP quiere rédito electoral. La vice, De la, ha venido a decir cuatro lugares comunes de esos que le encantan al Gobierno (que si “ETA no future”, que si van a acabar en la cárcel… pero nada de enseñar la mano dura). ANV, ese partido demócrata legalizado contra la opinión fachorra del PP, no condena el atentado. Y las declaraciones del presidente francés han hecho asomar alguna lagrimilla nostálgica a mis ojos… (yo quiero vivir en una República con un presi así, ay).Y, bueno, al autor del blog y los que le apoyan he de decirles que da la sensación de que están mucho más preocupados por la ventaja que pudiera tomar el PP que por el atentado en sí, lo que por más ruin que parezca no deja de tener su lógica, después de que un megaatentado concediese una evidente ventaja al partido que actualmente nos gobierna.Por último, a los de siempre, a aquéllos que repiten como loros lo de “el PP se habrá alegrado mucho”, a esos más vale ni contestarles, ¿para qué?. Esos ni han entendido ni entenderán nunca nada.

    24 Agosto 2007 | 16:33

  46. Dice ser Felipe.G

    Hoy es un día perfecto para no hablar demasiado.

    24 Agosto 2007 | 16:46

  47. Dice ser Manuel Saco

    Para El buen salvaje(Una digresión en el debate: El que se hace llamar El buen Salvaje, quien en su página se define como “algo insumiso, algo ignorante” deja esta nota culta sobre mi post, supongo que para hacer hincapié sobre la ignorancia mía:“Me he desayunado con ETA”¿Te has untado con ETA y luego te has comido? jajajajaaaaaaaa”Sólo quiero recordarle que el verbo desayunar, además de intransitivo, puede usarse como transitivo y pronominal. En este último caso, como pronominal, es como lo utilizo yo, tal como me enseñó mi padre desde mi más tierna infancia. Un verbo pronominal es aquel que se conjuga con el pronombre reflexivo, como morirse, lavarse, avergonzarse, levantarse… y desayunarse. Uno por las mañanas está en ayunas, y cuando toma algo de comida o bebida “se desayuna”. Unos se desayunan con galletas o con café con leche, o con un huevo frito, y otros, como yo hoy, nos desayunamos “con ETA”. Me alegra, en cualquier caso, que desde este momento seas un poco menos ignorante.)

    24 Agosto 2007 | 17:05

  48. Dice ser pericles

    Jose M. , en mi caso ni creo ser ignorante ni creo ser embustero. Tu caso, sin embargo, es mucho más claro, ya que eres simple y llanamente ambas cosas, además de un manipulador. Y con pleno conocimiento de causa, que es lo peor.19 detenciones deben parecerte pocas. ¿A cuántos se han de detener? ¿A todos los de Batasuna y ANV, existan pruebas o no? Pues menudo demócrata, que ni siquiera cree en el Estado de derecho. ¿Qué es lo siguiente? ¿La invasión del País Vasco como guerra preventiva? ¿Encerrarlos a todos en un estadio de fútbol y aplicarles picanas eléctricas? Seamos serios, lo que sólo son diferencias a la hora de las estrategias para terminar con el terrorismo no se pueden utilizar como forma de ventaja ni confrontación política. Aquí te dejo una relación de los hechos para ver quien miente, quien manipula y quien es un perfecto ignorante. Desde que ETA rompió la tregua se terminó el diálogo y se continuó la lucha contra el terrorismo con todos los medios policiales y judiciales necesarios. Si tienes datos que demuestren lo contrario, apórtalos o no hables, pero deja ya de manipular:http://www.lavanguardia.es/lv24h/20070824/53388194325.htmlhttp://www.abc.es/20070824/nacional-terrorismo/terroristas-detenihttp://www.diariovasco.com/20061130/aldia/etarras-detenidos-desde…Realmente, yo no si el PSOE negoció o habló con Batasuna, durante la anterior tregua de Aznar o después o no. Aquí las versiones son contradictorias y con diferencias importantes, tanto de matiz, como sobre los contenidos, según el interés de quien ofrezca las informaciones. Lo que sí que tengo claro es que ETA, tras el bombazo de la Terminal de Barajas dio por roto todo entendimiento y diálogo unilateralmente, y que durante la tregua las concesiones fueron mínimas y que desde esa fecha la intensidad en la persecución de los terroristas han sido las máximas. Todo lo demás son interpretaciones interesadas. Quedémonos con los hechos: no hubo cesiones, siguieron las detenciones y tras el final de la tregua, la persecución judicial y la colaboración con Francia se han visto intensificadas:http://www.elpais.com/articulo/reportajes/fue/dialogo/ETA/elpepushttp://www.libertaddigital.com/noticias/noticia_1276307416.htmlhttp://www.rebelion.org/noticia.php?id=51110Las dos últimas fuentes, me parecen muy poco fiables, por la evidente intencionalidad y sectarismo de los medios de comunicación, pero también las dejo aquí.Y mejor será dejar las alusiones personales, que a nada conducen, y quedémonos con los hechos y con los argumentos.Saludos.

    24 Agosto 2007 | 17:14

  49. Dice ser Pepe

    Jose MPero cómo te puedes atrever tú a hablar sobre la violencia? El tipo más violento que pisa estos foros, después de haberle ofrecido unas hostias a Martínez Soler en su blog, amén de otras varias a mí, todavía te atreves a seguir opinando sobre terrorismo, poniendo cara de no haber roto un plato?. Qué cinismo chaval. Eres el perfecto paradigma del facha, cuando se le contradice…a pegarse. Sobre lo único que puedes ilustranos es sobre tus similitudes con los animales de Eta, porque eres igual que ellos, si no hacen lo que quiero… a hostias.(Si quieres vuelvo a publicar aquel post en el que te retrataste insultando a diestro y siniestro como un energúmeno, ¿verdad bonito?)

    24 Agosto 2007 | 17:16

Los comentarios están cerrados.